View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_518 (Length: 217)
Name: NF7829A_low_518
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_518 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 36211970 - 36211795
Alignment:
| Q |
15 |
gtttggtgttggttgtgggaagaggactataaggaattggctaggactaggagaataactggatgagtttgtgtggactaaggagtgatcaatattggtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
36211970 |
gtttggtgttggttgtgggaagaggactataaggaattggctagga------gaataactggatgagtttgtatggactaaggagtgatcgatattggtt |
36211877 |
T |
|
| Q |
115 |
gctcttcactgccttgatgtaattagaggcaatagacggtggatttattggtgtaatggaggaatggaaagggcatgtttga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36211876 |
gctcttcactgccttgatgtaattagaggcaatagacggtggatttattggtgtaatggaggaatggaaagggcatgtttga |
36211795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University