View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_519 (Length: 217)
Name: NF7829A_low_519
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_519 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 13 - 166
Target Start/End: Complemental strand, 2442849 - 2442696
Alignment:
| Q |
13 |
agttcatctcactgacactgtttaccggaaattgatcgagggctcctctatattaccattttacaatgcaattctagaaattttgtatcattctatcgca |
112 |
Q |
| |
|
|||||||| |||| |||||||||||| ||||||||||||||||| || ||||||||||||||||||| | || || ||||||||||||||||||||||| |
|
|
| T |
2442849 |
agttcatcacactaacactgtttaccagaaattgatcgagggcttctttatattaccattttacaatcaatttatacaaattttgtatcattctatcgca |
2442750 |
T |
|
| Q |
113 |
tgcagagcaagatagtctgaaaatggttgcaaaaagagaagctagagttcggtc |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2442749 |
cgcagagcaagatagtctgaaaatggttgcaaaaagagaagctagagttcggtc |
2442696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 40 - 129
Target Start/End: Original strand, 50984241 - 50984328
Alignment:
| Q |
40 |
gaaattgatcgagggctcctctatattaccattttacaatgcaattctagaaattttgtatcattctatcgcatgcagagcaagatagtc |
129 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| |||| |||||||| ||||||||| | | ||| || ||||||||||||||||||| |
|
|
| T |
50984241 |
gaaattgattgagggcttctctatattaccatttt-caat-caattctacaaattttgttttaatctgtcacatgcagagcaagatagtc |
50984328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 117 - 153
Target Start/End: Original strand, 34019916 - 34019952
Alignment:
| Q |
117 |
gagcaagatagtctgaaaatggttgcaaaaagagaag |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34019916 |
gagcaagatagtctgaaaatggttgcaaaaagagaag |
34019952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University