View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_521 (Length: 216)
Name: NF7829A_low_521
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_521 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 201
Target Start/End: Complemental strand, 10567054 - 10566857
Alignment:
| Q |
4 |
tcaatgagatggacatcaactcggaggttccatgtatggggactgattatttagagttcatgaagacgattagatctattccagaccgtggtgagtttga |
103 |
Q |
| |
|
||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10567054 |
tcaatgagaaggaaaacaactcggaggttccatgtatggggactgattatttagagttcatgaagacgattagatctattccagaccgtggtgagtttga |
10566955 |
T |
|
| Q |
104 |
aagtcaatatagtgctatctctgagttatatagttgttctggaccctcagtaacatcctcttggcaaaaggaccaaagtaaatttgtagtgatgtcca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10566954 |
aagtcaatatagtgctatctctgagttatatagttgttctggaccctcagtaacatcctcttggcaaaaggaccaaagtaaatttgtagtgatgtcca |
10566857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University