View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_527 (Length: 213)
Name: NF7829A_low_527
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_527 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 83 - 188
Target Start/End: Complemental strand, 13879675 - 13879570
Alignment:
| Q |
83 |
gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879675 |
gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg |
13879576 |
T |
|
| Q |
183 |
atgtct |
188 |
Q |
| |
|
|||||| |
|
|
| T |
13879575 |
atgtct |
13879570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 93 - 188
Target Start/End: Complemental strand, 13875448 - 13875353
Alignment:
| Q |
93 |
atcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattgatgtct |
188 |
Q |
| |
|
||||||||||||| |||||| |||||| ||||||||| ||||||| |||| |||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13875448 |
atcttgttctctgtgattttgaggagaccgaggagtctttgatttttcggttgaatctggtcgccaacaacgtgaggaaggaagagattgatgtct |
13875353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University