View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_528 (Length: 213)
Name: NF7829A_low_528
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_528 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 41103885 - 41104063
Alignment:
| Q |
18 |
acatcatagcggattgtagactcttaacggctttaagatagcgtttggcttcttgacgagtgttggtgaaaagagaattagaatggttagaagaagtaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103885 |
acatcatagcggattgtagactcttaacggctttaagatagcgtttggcttcttgacgagtgttggtgaaaagagaattagaatggttagaagaagtaga |
41103984 |
T |
 |
| Q |
118 |
gacagtgttccatttggttataagagtgcgtgcggtttctatgttttcatcaactattgcgtctgagaatgttttgttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103985 |
gacagtgttccatttggttataagagtgcgtgcggtttctatgttttcatcaactattgcgtctgagaatgttttgttt |
41104063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University