View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_529 (Length: 213)
Name: NF7829A_low_529
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_529 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 17 - 154
Target Start/End: Original strand, 10274651 - 10274788
Alignment:
| Q |
17 |
atgaaatagggtaatgataaaatgaagttagataaagaagagttcataaaaagccaaagactaatgaagtggaaataaactttggcttacataagcaaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10274651 |
atgaaatagggtaatgataaaatgaagttagataaagaaaagttcataaaaagccaaagactaatgaagtggaaataaactttggcttacataagcaaaa |
10274750 |
T |
 |
| Q |
117 |
tgtgtcatccaaacttaaccgttcatttacaatttctt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10274751 |
tgtgtcatccaaacttaaccgttcatttacaatttctt |
10274788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 17 - 86
Target Start/End: Original strand, 10266736 - 10266805
Alignment:
| Q |
17 |
atgaaatagggtaatgataaaatgaagttagataaagaagagttcataaaaagccaaagactaatgaagt |
86 |
Q |
| |
|
||||||| |||||| |||||||| ||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
10266736 |
atgaaatggggtaacgataaaataaagttagataaagaaatgttcagaaaaagccaaagactaatgaagt |
10266805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University