View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_530 (Length: 212)
Name: NF7829A_low_530
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_530 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 20 - 201
Target Start/End: Complemental strand, 7861657 - 7861476
Alignment:
| Q |
20 |
atcattaacatttctacaaatcgaataataataacaacaacaattataatagaactnnnnnnntgaatcgagagtnnnnnnnttaccctatcttcaggat |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
7861657 |
atcattaacatttctacgaatcgaataataataacaacaacaattataatagaaactaaaaaatgaatcgagagtaaaaaaattaccctatcttcaggat |
7861558 |
T |
|
| Q |
120 |
gaaaacaaggatgaatgattccattcatgtcaagatagagattatcatattcaaggttattagggttgggtttgctgatgtc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7861557 |
gaaaacaaggatgaatgattccattcatgtcaagatagagattatcatattcaaggttattagggttgggtttgctggtgtc |
7861476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 115 - 171
Target Start/End: Complemental strand, 18782173 - 18782117
Alignment:
| Q |
115 |
aggatgaaaacaaggatgaatgattccattcatgtcaagatagagattatcatattc |
171 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
18782173 |
aggatgaaaacaaggatgaataatagaattcatgtcaagataaagattatcatattc |
18782117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University