View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_531 (Length: 212)
Name: NF7829A_low_531
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_531 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 32 - 207
Target Start/End: Complemental strand, 7922419 - 7922244
Alignment:
| Q |
32 |
acatcaatatgctccctcaattgattgttattgaaattaaggtctgttttcctattaaactcatcacggatgtgattccacgttttcttgtcaaaagtat |
131 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7922419 |
acatcaagatgcttcctcaattgattgttattgaaattaaggtctgttttcctattaaactcatcacggatgtgattccacgttttcttgtcaaaagtat |
7922320 |
T |
 |
| Q |
132 |
cgttttgtctattccccagttgaatctgcttaacaaccgagtctgcaaatatcttgccaagtgatgatgtccatct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
7922319 |
cgttttgtctattccccagttgaatctgcttaacaaccaagtctgcaaatatcttgtcaagtgatgctgtccatct |
7922244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University