View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_533 (Length: 211)
Name: NF7829A_low_533
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_533 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 21 - 196
Target Start/End: Complemental strand, 45096961 - 45096786
Alignment:
| Q |
21 |
ttcttatgcttggtggtctcagttgcctaaccaaattagagacgattatattagaaatagattaggttttgcaatttacgattttgttagctctttttga |
120 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45096961 |
ttcttatgcttggtggtttcagttgcctaaccaaattagagacgactatattagaaatagattaggttttacaatttacgattttgttagctctttttga |
45096862 |
T |
 |
| Q |
121 |
gggtttggtcttatatcccattcttttcattgtacctttttagcttatcaatgtattttgggtcttgcttcatctc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45096861 |
gggtttggtcttatatcccattcttttcattgtacctttttagcttatcaatgtattttgggtcttgcttcatctc |
45096786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University