View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_535 (Length: 211)
Name: NF7829A_low_535
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_535 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 33532959 - 33533137
Alignment:
| Q |
15 |
aaaaatatgacaaaaatcgaagtacttgtatccattccatcaagttttcaaatcaaatagttacatgcagaannnnnnnnataacatcacatggccttta |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33532959 |
aaaagtatgacaaaaatcgaagtacttgtatccattccatcaagttttcaaatcaaatagttacatgcagaattttttttataacatcacatggccttta |
33533058 |
T |
|
| Q |
115 |
agaacatgctgtctatgtagaaccgacacatgtggtcacgattcacattcaaatacttcactttctcaaattattactg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33533059 |
agaacatgctgtctatgtagaaccgacacatgtggtcacgattcacattcaaatacttcactttctcaaattattactg |
33533137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 191
Target Start/End: Complemental strand, 47892716 - 47892684
Alignment:
| Q |
159 |
acattcaaatacttcactttctcaaattattac |
191 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
47892716 |
acattcaaatatttcactttctcaaattattac |
47892684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University