View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_536 (Length: 210)
Name: NF7829A_low_536
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_536 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 22 - 192
Target Start/End: Complemental strand, 19796431 - 19796261
Alignment:
| Q |
22 |
tgtccatactcttggtcttaccctttccttcattacagattttgaagatgtcgttatagaagctctcatcggcagcagcgatgtatgccctggctaccac |
121 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19796431 |
tgtccatactcttggtcttatcctttccttcatttcagattttgaagatgtcattatagaagctctcatcggcagcagcgatgtataccctggctaccac |
19796332 |
T |
|
| Q |
122 |
ctctgaagtttgtcaaattagtttgacatggtgatgtgtatgaattaaatcctttttaagtgtgttctatg |
192 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||| |
|
|
| T |
19796331 |
ctctgaagattgtcaaattagtttgacatggtgatgtatatgaattaaatccttttttaatgtgttctatg |
19796261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 30 - 100
Target Start/End: Original strand, 6322910 - 6322982
Alignment:
| Q |
30 |
ctcttggtcttaccctttccttcattacagattttgaagatgtcgttatagaagctct--catcggcagcagc |
100 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| ||| ||||| || ||||||||||| ||||||||||||| |
|
|
| T |
6322910 |
ctcttggtctcaccccttccttcattacagatcttgcagatgcagtgatagaagctcttccatcggcagcagc |
6322982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University