View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_548 (Length: 204)
Name: NF7829A_low_548
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_548 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 13 - 204
Target Start/End: Original strand, 34899524 - 34899714
Alignment:
| Q |
13 |
atctatgaagaagtgtctgctaagacttacaaataattagttggtagctgaatgcagaaaattgaatatcgaaaatgtgtctctaaaaatgttcttagtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899524 |
atctatgaagaagtgtctgctaagacttacaaataattagttggtagctgaatgcagaaaattgaatatcgaaaatgtgtctctaaaaatgttcttagtt |
34899623 |
T |
|
| Q |
113 |
attaggagaacctcaattagtgggtcagttgacatgttccacttggtttttatgcgtaacgtaccacacaagcatatgcaaatgttataata |
204 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34899624 |
attaggagaacctcaactagtgggtcagttgacatgttccacttggtttttatgcgtaa-gtaccacacaagcatatgcaaatgttataata |
34899714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University