View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_553 (Length: 203)
Name: NF7829A_low_553
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_553 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 39 - 183
Target Start/End: Original strand, 37969581 - 37969725
Alignment:
| Q |
39 |
atggcaaagaagcccgtgaactttgaattggatatgaatcttggtgtcaggatgacggcttcgggactcaaaacatgggttatgacatctcatgttgttt |
138 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37969581 |
atggcaaagatgcccgtgaactttgaattggatatgaatcttggtgtgaggatgacggcttcgggactcaaaacatgggttatgacatctcatgttgttt |
37969680 |
T |
 |
| Q |
139 |
gtaaatttaaggttaacaatcttgggaaggattcgaaaatcttgt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37969681 |
gtaaatttaaggttaacaatcttgggaaggattcgaaaatcttgt |
37969725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University