View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_64 (Length: 399)
Name: NF7829A_low_64
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_64 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0002 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 15 - 399
Target Start/End: Original strand, 338419 - 338803
Alignment:
| Q |
15 |
acatcaactgctattactcttacaaattatccacggaaacattgtaaccgaaacagtttgtgtaacatacatttagatgcctaacacacctggtcttttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
338419 |
acatcaactgctattactcttacaaattatccacggaaacattgtaaccgaaacagtttgtgtaacatacatttagatgcctaacacacctggtcttttg |
338518 |
T |
|
| Q |
115 |
aaattaactaaattcttgaggactagtacaattatcactacctatcttttctcttcatctttttattttgctggtgttacgttttgcatgaaaatatagt |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
338519 |
aaattaagtaaattcttgaggactagtacaattatcactacctatcttttctcttcatctttttattttgctggtgttacgttttgcatgaaaatatagt |
338618 |
T |
|
| Q |
215 |
atatttttgctgcattaactatgcagctgaatttgataaactttggtacttaataccaattttgcattgtattcttatgagggtacaacatttaaggaaa |
314 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
338619 |
atttttttgctgcattaactatgcagctgaatttgataaactttggtacttaataccatttttgcattgtattcttatgagggtacaacatttaaggaaa |
338718 |
T |
|
| Q |
315 |
gcatattgggatacaataatatattaaaaattgttgtttgggttgatactaaatattttttactttggttaaatgtcaggcaagt |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
338719 |
gcatattgggatacaataatatattaaaaattgttgtgtgggttgatactaaatattttttactttggttaaatgtcaggcaagt |
338803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University