View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_67 (Length: 395)
Name: NF7829A_low_67
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_67 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 1 - 386
Target Start/End: Complemental strand, 35939678 - 35939292
Alignment:
| Q |
1 |
tcaattgtttcttggcaggtaaacatattgatagtggcacagctgtttcaccattagctggtaagctgtttgttgttattggggccggtggtgctgggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35939678 |
tcaattgtttcttggcaggtaaacataatgatagtggcacagctgtttcaccattagatggtaagctgtttgttgttattggggccggtggtgctgggaa |
35939579 |
T |
|
| Q |
101 |
ggcacttgcttatggtgcaaaagagaaaggagcaaggattgtgattgcaaaccgcacctatggtaagcttcatgataagtattttcccgcctagagttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35939578 |
ggcacttgcttatggtgcaaaagagaaaggagcaaggattgtgattgcaaaccgcacctatggtaagcttcatgataagtattttcccgcctagagttaa |
35939479 |
T |
|
| Q |
201 |
aagaagttgaattgcaaaaggctattccaggatcttg-ttcaaaacaccatatattggagatagctgatgataagatgaattcttttaattgattaaatg |
299 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35939478 |
aaaaagttgaattgcaaaaggctattccaggatcttgtttcaaaacaccatatattggagatagctgatgataagatgaattcttttaattgattaaatg |
35939379 |
T |
|
| Q |
300 |
gatggtagttatcttcatgagatgctttcttgggttctatttcttctcgtgtctctagatatcaacttgcattctgtagatattatt |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35939378 |
gatggtagttatcttcatgagatgctttcttgggttctatttcttctcgtgtctctagatatcaacttgcattctgtagatattatt |
35939292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University