View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7830_low_10 (Length: 243)
Name: NF7830_low_10
Description: NF7830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7830_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 138 - 238
Target Start/End: Complemental strand, 26297904 - 26297804
Alignment:
| Q |
138 |
gattaaatacataaatcaagtagaataaatgttgaagattttctacttataaaacttaaatgttgaagatttcttgctaaacaagtgatgatgatgtcca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
26297904 |
gattaaatacataaatcaagtagaataaatgttgaagattttctacttataaaacttaaatgttgaagatttcttgttaaacaagtgatgatgatttcca |
26297805 |
T |
|
| Q |
238 |
t |
238 |
Q |
| |
|
| |
|
|
| T |
26297804 |
t |
26297804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 65 - 145
Target Start/End: Complemental strand, 26298532 - 26298452
Alignment:
| Q |
65 |
gctcaagacaaacatgcacccattttttatattatttataactacctatgaaactttggttttgagtttatgtgattaaat |
145 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
26298532 |
gctcaagacaaacttgcacccattttttagattatttataactacctatgtaactttggatttgagtttatgtgattaaat |
26298452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University