View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7831_low_22 (Length: 238)
Name: NF7831_low_22
Description: NF7831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7831_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 19698349 - 19698550
Alignment:
| Q |
18 |
agaaacattttctcgcatgcaacccttgccttacagtatccaatgttgcgacagaatgattatttgtttgctgaatttccagttccaagatgaggggaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19698349 |
agaaacattttctcgcatgcaacccttgccttacagtatccaaggttgcgacagaatgattgtttgtttgctgaatttccagttccaagatgaggggaat |
19698448 |
T |
|
| Q |
118 |
atgtcccaaaccattatttcgaaccaatgtagatgtgtcaacaatttcgtttgtggcattcgataaagcaaaatgaaaggaggagctagccttggaaggt |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19698449 |
atgtcccaaaccattatttcaaaccaatgtaaatgtgtcaacaatttcgtttgtggcattcgataaagcaaaatgaaaagaggagctagccttggaaggt |
19698548 |
T |
|
| Q |
218 |
ac |
219 |
Q |
| |
|
|| |
|
|
| T |
19698549 |
ac |
19698550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 216
Target Start/End: Original strand, 25440754 - 25440843
Alignment:
| Q |
127 |
accattatttcgaaccaatgtagatgtgtcaacaatttcgtttgtggcattcgataaagcaaaatgaaaggaggagctagccttggaagg |
216 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||||||||| || ||||| || |||||||||||| |||||| | ||||| ||||| |
|
|
| T |
25440754 |
accattatttcgaatcaatgtagacatatcaacaatttcgtccatgacattctttacagcaaaatgaaaagaggagttggcctttgaagg |
25440843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University