View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7832_high_28 (Length: 280)

Name: NF7832_high_28
Description: NF7832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7832_high_28
NF7832_high_28
[»] chr4 (1 HSPs)
chr4 (11-262)||(45477172-45477420)


Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 262
Target Start/End: Complemental strand, 45477420 - 45477172
Alignment:
11 gtagcagagacaataatcaatgaagacatgcctgctgttgctcagattgtgttgcgtgtgtaaactgggaagtgcaggtgcaaaattatttttagtgaag 110  Q
    |||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45477420 gtagcaaagacaataatcaatggagacatgcctgttgttgctcagattgtgttgcgtgtgtaaactgggaagtgcaggtgcaaaattatttttagtgaag 45477321  T
111 attgtgcaagtgtaatttcttctaaacaatagtgagcaatggcgcgtagattcaaaatctcaagatgatgatatgatatgatatgctatgccatgaaccc 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45477320 attgtgcaagtgtaatttcttctaaacaatagtgagcaatggcgcgtagattcaaaatctcaagatgatgatatgatatgatatgctatgccatgaaccc 45477221  T
211 taatgtgctggttctatattttatgaatgaatgaattggtggtgtgtcatat 262  Q
       |||||||||||||||||||||||||||||||||||||||||||||||||    
45477220 ---tgtgctggttctatattttatgaatgaatgaattggtggtgtgtcatat 45477172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University