View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7832_high_35 (Length: 238)
Name: NF7832_high_35
Description: NF7832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7832_high_35 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 4749371 - 4749131
Alignment:
| Q |
1 |
tattattgtttctcctcttatgatccaccaagcctttcaacagcttcaccaacttctttcgtgcctaaacacaataggannnnnnnaaatgtaactataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4749371 |
tattattgtttctcctcttatgatccaccaaacctttcaacagcttcaccaacttctttcgtgcctaaacacaataggatttttttaaatgtaactataa |
4749272 |
T |
|
| Q |
101 |
ggtgtgaatcaaattgtgtacttagatgaataaatgagtatataatt---taccttgagtgctttatagaatggaaagccaggaagattgatcgattggg |
197 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4749271 |
ggtgtaaatcaaattgtgtacttagatgaataaatgagtatataattaattaccttgagtgctttatagaatggaaagccaggaagattgatcgattggg |
4749172 |
T |
|
| Q |
198 |
acctcattcctcgaagcaaatcaatgtacaaatgctcaacc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4749171 |
acctcattcctcgaagcaaatcaatgtacaaatgctcaacc |
4749131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 4757855 - 4757783
Alignment:
| Q |
1 |
tattattgtttctcctcttatgatccaccaagcctttcaacagcttcaccaacttctttcgtgcctaaacaca |
73 |
Q |
| |
|
||||||| || ||||| || |||||||||||| ||| ||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
4757855 |
tattattattcctccttttttgatccaccaaggcttgcaatagcttcatcaacttctttcttgcctaaacaca |
4757783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University