View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7832_low_16 (Length: 446)
Name: NF7832_low_16
Description: NF7832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7832_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 7e-93; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 7e-93
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 1270392 - 1270589
Alignment:
| Q |
19 |
gttacaacatggtaaagttactgatttgaagtgcctttgtcttgatgcaggggcagggatgaatagcatgcttgagcagggttcagtggtgggcaaagaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1270392 |
gttacaacatggtaaagttactgatttgaagtgcctttgtcttgatgcaggggcagggatgaatagcattcttgagcagggttcagtggtgggcaaagaa |
1270491 |
T |
|
| Q |
119 |
cctgatgaacaaaccaaagaaattttccgtccatatcgtgtcttttgtgcgcgaaaagatgtaagtttcacnnnnnnnccaggatagaaaacaagagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1270492 |
cctgatgaacaaaccaaagaaattttccgtccatatcgtgtcttttgtgcgcgaaaagatgtaagtttcacttttttcccaggatagaaaacaagagg |
1270589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 300 - 436
Target Start/End: Original strand, 1270673 - 1270809
Alignment:
| Q |
300 |
gataggtacactgcaaggacgttgtagtagaacatggagatgtatccaaagctttaattgaatatacttctcaatcagcaattgagcatttggttctagg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1270673 |
gataggtacactgcaaggacgttgtagtagaacatggagatgtatgcaaagctttaattgaatatacttctcaatcagcaattgagcatttggttctagg |
1270772 |
T |
|
| Q |
400 |
ctgttccaacaaaaatggttttctcaagtattcttct |
436 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1270773 |
ctgttccaacaaaaatggttttctcaagtattcttct |
1270809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 90 - 155
Target Start/End: Original strand, 1257459 - 1257524
Alignment:
| Q |
90 |
ttgagcagggttcagtggtgggcaaagaacctgatgaacaaaccaaagaaattttccgtccatatc |
155 |
Q |
| |
|
||||| |||||||| ||||| ||||| | ||| ||||||||||||||||||| || |||| ||||| |
|
|
| T |
1257459 |
ttgaggagggttcactggtgtgcaaaaagcctaatgaacaaaccaaagaaatgtttcgtctatatc |
1257524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University