View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7832_low_30 (Length: 280)
Name: NF7832_low_30
Description: NF7832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7832_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 262
Target Start/End: Complemental strand, 45477420 - 45477172
Alignment:
| Q |
11 |
gtagcagagacaataatcaatgaagacatgcctgctgttgctcagattgtgttgcgtgtgtaaactgggaagtgcaggtgcaaaattatttttagtgaag |
110 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45477420 |
gtagcaaagacaataatcaatggagacatgcctgttgttgctcagattgtgttgcgtgtgtaaactgggaagtgcaggtgcaaaattatttttagtgaag |
45477321 |
T |
 |
| Q |
111 |
attgtgcaagtgtaatttcttctaaacaatagtgagcaatggcgcgtagattcaaaatctcaagatgatgatatgatatgatatgctatgccatgaaccc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45477320 |
attgtgcaagtgtaatttcttctaaacaatagtgagcaatggcgcgtagattcaaaatctcaagatgatgatatgatatgatatgctatgccatgaaccc |
45477221 |
T |
 |
| Q |
211 |
taatgtgctggttctatattttatgaatgaatgaattggtggtgtgtcatat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45477220 |
---tgtgctggttctatattttatgaatgaatgaattggtggtgtgtcatat |
45477172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University