View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7832_low_31 (Length: 279)
Name: NF7832_low_31
Description: NF7832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7832_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 10 - 272
Target Start/End: Complemental strand, 41783338 - 41783080
Alignment:
| Q |
10 |
attaaggaggaaaatgacagagagagtagtatttaagaagatataaggtgggtccaaatgcgagnnnnnnnnnnnnnatgcttagagttcggtttagtag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41783338 |
attaaggaggaaaatgacagagagagtagtatttaagaagatataaggtgggtccaaatgcgagttttttttt----atgcttagagttcggtttagtag |
41783243 |
T |
 |
| Q |
110 |
ttggactgaacgactatacaaatagtacaagtacaactcacctgctattagttggacttggtacagcttgcaccctcaaacatgcagacaacttaacagt |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41783242 |
ttggacggaacgactatacaaatagtacaaatacaactcacctgctatttgttggacttggtacagcttgcaccctcaaacatgcagacaacttaacagt |
41783143 |
T |
 |
| Q |
210 |
caccacccctaacaatttattttatttcatttctttaagcaattcatttcatttcgtgtgtgc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41783142 |
caccacccctaacaatttattttatttcatttctttaagcaattcatttcatttcgtgggtgc |
41783080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University