View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7832_low_34 (Length: 251)
Name: NF7832_low_34
Description: NF7832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7832_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 53833599 - 53833734
Alignment:
| Q |
1 |
tgatttgttatgaaactaatcttcgaatcggagaaaagaaatcactttttctctttaaaatgaacgacttctgaaatcaaactcgggttattctataaga |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||| |||||||||||| ||||||||||||| |||||| |||| |||||||||||||||| |
|
|
| T |
53833599 |
tgatttgttatgaaattaatcttcgaatcgcagaaaagaaatctctttttctctttcaaatgaacgacttttgaaattcaacttgggttattctataaga |
53833698 |
T |
 |
| Q |
101 |
gaagtaatatcaactcttccaacactatattagttg |
136 |
Q |
| |
|
||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
53833699 |
gaagtgatatcaactcttccgacactaaattagttg |
53833734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 184 - 235
Target Start/End: Original strand, 53833783 - 53833834
Alignment:
| Q |
184 |
gaatgaataatagattggtgctactttgtaaaagataaatagattgcttctt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53833783 |
gaatgaataatagattggtgctactttgtaaaagataaatagattgcttctt |
53833834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University