View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7832_low_38 (Length: 219)
Name: NF7832_low_38
Description: NF7832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7832_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 29543539 - 29543721
Alignment:
| Q |
19 |
gatggttgtgtttcgaaacatcgttatggcgtgccttggaatgtcttgatcatatggagacttggaccaccaggaacacaacagattcaccggggccgca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29543539 |
gatggttgtgtttcgaaacatcgttatggcgtgccttggaatgtcttgatcatatggagacttggaccaccaggaacacaacagattcaccggggccgca |
29543638 |
T |
|
| Q |
119 |
ttcagccacattctgcatccacgcggtctccacttcaactactattggatcaagatcagacaattcatcgcttgtggtttgat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
29543639 |
ttcagccacattctgcatccacgcggtctccacttcaactactattggatcaagatcagacaattcatcgtttgtgttttgat |
29543721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University