View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7833_high_3 (Length: 394)
Name: NF7833_high_3
Description: NF7833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7833_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 19 - 391
Target Start/End: Complemental strand, 28985120 - 28984748
Alignment:
| Q |
19 |
acgtggcaactgccattgttgatagttatgcaaagttagggtttattcatttggcaaggcgggtttttgatcagtcacaaagtaggagcttgataatttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28985120 |
acgtggcaactgccattgttgatagttatgcaaagttagggtttattcatttggcaaggcgggtttttgatcagtcacaaagtaggagcttgataatttg |
28985021 |
T |
|
| Q |
119 |
gacttcaattatatatgcttatgcttctcatggagatgctagtttagcacttggtctctataaccagatgttagatagaggaattcagcctgacccagtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28985020 |
gacttcaattatatatgcttatgcttctcacggagatgctagtttagcacttggtctctataaccagatgttagatagaggaattcagcctgacccagtt |
28984921 |
T |
|
| Q |
219 |
acattgacttctgtgttgacagcttgtgctcattccgggctggtgaatgaagcttgggatgttttcaacgtgatgccttcgaaacatgggattcaacctg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28984920 |
acattgacttctgtgttgacagcttgtgctcattccgggctggtgaatgaagcttgggatgttttcaacgcgatgccttcgaaacatgggattcaacctg |
28984821 |
T |
|
| Q |
319 |
tggtggagcactatgcctgcatggttggtgttcttagtcgagctggaaagctctcagaagcggaaaagttcat |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28984820 |
tggtggagcactatgcctgcatggttggtgttcttagtcgagctggaaagctctcagaagcggaaaagttcat |
28984748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University