View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7833_high_5 (Length: 216)
Name: NF7833_high_5
Description: NF7833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7833_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 24402093 - 24402271
Alignment:
| Q |
20 |
gaaatctcttgacagggtttggtttttatgagccttactggcttgttgacattgccaatgtttgcattatggttcatttggttggaggttatcaggtact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24402093 |
gaaatctcttgacagggtttggtttttatgagccttactggcttgttgacattgccaatgtttgcattatggttcatttggttggaggttatcaggtact |
24402192 |
T |
 |
| Q |
120 |
actcgtgtcaaattgacgaaacaattctgccgtcattgttgttttctgatattaactttttctaatacatttgcttcat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24402193 |
actcgtgtcaaattgacgaaacaattctaccgtcattgttgttttctgatattaactttttctaatacatttgcttcat |
24402271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 20 - 123
Target Start/End: Original strand, 24379289 - 24379392
Alignment:
| Q |
20 |
gaaatctcttgacagggtttggtttttatgagccttactggcttgttgacattgccaatgtttgcattatggttcatttggttggaggttatcaggtact |
119 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
24379289 |
gaaatctcttgacagggtttgggttttatgagccttactggcttattgaccttgccaatgtttgcattatcattcatttggttggaggatatcaggtact |
24379388 |
T |
 |
| Q |
120 |
actc |
123 |
Q |
| |
|
|||| |
|
|
| T |
24379389 |
actc |
24379392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 20 - 123
Target Start/End: Original strand, 24414346 - 24414449
Alignment:
| Q |
20 |
gaaatctcttgacagggtttggtttttatgagccttactggcttgttgacattgccaatgtttgcattatggttcatttggttggaggttatcaggtact |
119 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| |||||| ||||||||||||||||||| ||||| |||||||||||||||| ||||||||||| |
|
|
| T |
24414346 |
gaaatctcttgacagggtttggattttttgagccttattggcttattgacattgccaatgtttgtattatcattcatttggttggaggctatcaggtact |
24414445 |
T |
 |
| Q |
120 |
actc |
123 |
Q |
| |
|
|||| |
|
|
| T |
24414446 |
actc |
24414449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 20 - 121
Target Start/End: Complemental strand, 24419615 - 24419514
Alignment:
| Q |
20 |
gaaatctcttgacagggtttggtttttatgagccttactggcttgttgacattgccaatgtttgcattatggttcatttggttggaggttatcaggtact |
119 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| |||||| ||||||||||||||||||| ||||| |||||||||||||||| ||||||||||| |
|
|
| T |
24419615 |
gaaatctcttgacagggtttggattttttgagccttattggcttattgacattgccaatgtttgtattatcattcatttggttggaggctatcaggtact |
24419516 |
T |
 |
| Q |
120 |
ac |
121 |
Q |
| |
|
|| |
|
|
| T |
24419515 |
ac |
24419514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 42362504 - 42362601
Alignment:
| Q |
20 |
gaaatctcttgacagggtttggtttttatgagccttactggcttgttgacattgccaatgtttgcattatggttcatttggttggaggttatcaggta |
117 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||| || || ||||| ||||| |||| |||| ||||||| | |||||||||| ||||| ||||||||| |
|
|
| T |
42362504 |
gaaacctcttgacaggttttggattttatgaaccatattggctcattgactttgctaatgcttgcattgttcttcatttggtgggaggatatcaggta |
42362601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University