View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7833_low_5 (Length: 334)
Name: NF7833_low_5
Description: NF7833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7833_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 316
Target Start/End: Complemental strand, 40748702 - 40748400
Alignment:
| Q |
17 |
tctcataagaagaagatnnnnnnnncaagttgtggatgatgtttacagtgatcaagtaacttgacaagtgtcattcccatagccttatacttgtatttca |
116 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40748702 |
tctcataagaagaagataaaaaaaacaagttgtggatgatgtttacagtgatcaagtaacttgacaagtgtcattcccatagccttatacttgtatttca |
40748603 |
T |
|
| Q |
117 |
aatccatcctctttgttccatcataccctcccttttttcttccttctacacttctcttcatcaactttgcaacttctcaaccaaactc-ttatgttttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40748602 |
aatccatcctctttgttccatcataccctcccttttttcttccttctacacttctcttcatcaactttgcaacttctcaaccaaactctttatgttttct |
40748503 |
T |
|
| Q |
216 |
cattttcttatacccttttagaaac-tcttcataaagtcttg-nnnnnnnattactacttttattatcaagtaccacaaacttagtgtttcttgaattct |
313 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40748502 |
cattttcttatacccttttagaaacttcttcataaagtcttgttttttttattactactcttattatcaagtaccacaaacttagtgtttcttgaattct |
40748403 |
T |
|
| Q |
314 |
aag |
316 |
Q |
| |
|
||| |
|
|
| T |
40748402 |
aag |
40748400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University