View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7834_high_5 (Length: 241)
Name: NF7834_high_5
Description: NF7834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7834_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 32222140 - 32221910
Alignment:
| Q |
1 |
cacataaaatgtacaacatcaaacaattgttagtcatacacgaaattttacaaacacatctacactttaaaatatcaactaacactttatatctcataat |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32222140 |
cacataaaatgtacagcatcaaacaattgttagtcatacatgaaattttacaaacatatctacactttaaaatatcaactaacactttatatctcataat |
32222041 |
T |
 |
| Q |
101 |
ttatcatatcttacgatatgcatatagataacattatctctttgttacgacgaacgataccatattcctcatttgctcttttaagagttttgtacg---- |
196 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
32222040 |
ttatcatatctcactatatgcatatagataacattatctctttattacgacgaacgataccatattcctcactcgctcttttaagagttttgtacgtacc |
32221941 |
T |
 |
| Q |
197 |
-agatatattcataaacttaacgatgtaact |
226 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
32221940 |
aagatctattcataaacttaacgatgtaact |
32221910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 142
Target Start/End: Original strand, 36956830 - 36956892
Alignment:
| Q |
80 |
taacactttatatctcataatttatcatatcttacgatatgcatatagataacattatctctt |
142 |
Q |
| |
|
|||||||| ||||| |||||||||||||| ||||| || |||||||| || | |||||||||| |
|
|
| T |
36956830 |
taacacttcatatcacataatttatcataccttactatgtgcatataaatcatattatctctt |
36956892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University