View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7835_high_2 (Length: 252)
Name: NF7835_high_2
Description: NF7835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7835_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 126 - 239
Target Start/End: Complemental strand, 41752477 - 41752364
Alignment:
| Q |
126 |
ggtgggagaaattaagaaagagagaagagtagaagtaggggaggattaaaacagagaagtttttggtgggatagtatttataggaagaatcttggtaata |
225 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41752477 |
ggtgggagaaattaaaaaagagagaagagtagaagtaggggaggattaaaacagagaagtttttggtgggatagtatttataggaagaatcttggtaata |
41752378 |
T |
 |
| Q |
226 |
aattggtgtgatat |
239 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41752377 |
aattggtgtgatat |
41752364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 2 - 79
Target Start/End: Complemental strand, 41752609 - 41752532
Alignment:
| Q |
2 |
gaaactagaccagcaactattatgagtggaaccataaacaataagagtttcacggatgaagatgaatatgattctaaa |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41752609 |
gaaactagaccagcaactattatgagtggaaccataaacaataagagtttcatggatgaagatgaatatgattctaaa |
41752532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University