View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7835_high_5 (Length: 247)
Name: NF7835_high_5
Description: NF7835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7835_high_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 23 - 247
Target Start/End: Original strand, 55178858 - 55179082
Alignment:
| Q |
23 |
tatgcatcctgcggagaagtggccaaccaagcttctgtgatgttgataatcttgatgacactttcatctcttctttaaatgtttcttcctcccattttct |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
55178858 |
tatgcatcctgcggagaagtggccaaccaagcttctgtgatgttgataatcttgatgacactttcatttctcctttaaatgtttcttcctcccattttct |
55178957 |
T |
 |
| Q |
123 |
gttaccttcttggcttttcgatttctcatcctcattctccgagtggtctgtgccagatgcagactggaccaccgtgctgataagactcggtctaggatcc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55178958 |
gttaccttcttggcttttcgatttctcatcctcattctctgagtggtctgtgccagatgcagactggaccaccgtgctgataagactcggtctaggatcc |
55179057 |
T |
 |
| Q |
223 |
tctataatgccacttagcataatca |
247 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
55179058 |
tctataatgccacctagcataatca |
55179082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University