View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7835_low_5 (Length: 292)
Name: NF7835_low_5
Description: NF7835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7835_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 16 - 276
Target Start/End: Complemental strand, 31553268 - 31553008
Alignment:
| Q |
16 |
atatagtagcagtatcattaaagaaggaaacaaaagaagccccttcttttttaaacatgtcttttcatatattcatacatatgcatgccatacacctcta |
115 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31553268 |
atataggagcagtattattaaagaaggaaacaaaagaagccccttcttttttaaacatgtcttttcatatattcatacatatgcatgccatacacctcta |
31553169 |
T |
 |
| Q |
116 |
tgatgatgatctaaagttttatattcagaatgattattctccattgtagcaggaaaaccttttcagttatgttaacgtgatgcaaggattatgtgcaagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31553168 |
tgatgatgatctaaagttttatattcagaatgattattctcccttgtagcaggaaaaccttttcagttatgttaacgtgatgcaaggattatgtgcaagg |
31553069 |
T |
 |
| Q |
216 |
gaattggacacattgtactgaaccatggaatctgagtcatcatttacatcaacatcacaat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31553068 |
gaattggacacattgtactgaaccatggaatctgagtcatcatttacatcaacatcacaat |
31553008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University