View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7835_low_7 (Length: 252)

Name: NF7835_low_7
Description: NF7835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7835_low_7
NF7835_low_7
[»] chr7 (2 HSPs)
chr7 (126-239)||(41752364-41752477)
chr7 (2-79)||(41752532-41752609)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 126 - 239
Target Start/End: Complemental strand, 41752477 - 41752364
Alignment:
126 ggtgggagaaattaagaaagagagaagagtagaagtaggggaggattaaaacagagaagtttttggtgggatagtatttataggaagaatcttggtaata 225  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41752477 ggtgggagaaattaaaaaagagagaagagtagaagtaggggaggattaaaacagagaagtttttggtgggatagtatttataggaagaatcttggtaata 41752378  T
226 aattggtgtgatat 239  Q
    ||||||||||||||    
41752377 aattggtgtgatat 41752364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 2 - 79
Target Start/End: Complemental strand, 41752609 - 41752532
Alignment:
2 gaaactagaccagcaactattatgagtggaaccataaacaataagagtttcacggatgaagatgaatatgattctaaa 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
41752609 gaaactagaccagcaactattatgagtggaaccataaacaataagagtttcatggatgaagatgaatatgattctaaa 41752532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University