View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7836_high_19 (Length: 221)
Name: NF7836_high_19
Description: NF7836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7836_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 205
Target Start/End: Complemental strand, 9233632 - 9233442
Alignment:
| Q |
15 |
atgaaccttggtttaatgcattatatatgaataggttttcctagttcttgactttgttgtttattgattagannnnnnnaataagttaaattagtccacc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9233632 |
atgaaccttggtttaatgcattatatatgaataggttttcctagttcttgactttgttgtttattgattagatttttttaataagttaaattagtccacc |
9233533 |
T |
 |
| Q |
115 |
caaattgttgtgattagcctaatcatgactttagtttacagcttgattagtcagtccaataatgcatttctttcattgcttatattcattt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9233532 |
caaattgttgtgattagcctaatcatgactttagtttacagcttgattagtcagtccaataatgcatttctttcattgctttcattcattt |
9233442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University