View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7836_high_20 (Length: 212)
Name: NF7836_high_20
Description: NF7836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7836_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 16815639 - 16815464
Alignment:
| Q |
20 |
ctaccacgcggtgagatatgagctaccgtgttcccaaatcggcgctatttcttgtaggttaggtttgtaaattccaaatttaaaactaaacatactacta |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16815639 |
ctaccacgcggtgagatgtgagctaccgtgttcccaaatcggcgctatttcttgtaggttaggtttgtaaattccaaatttaaaactaaacatactacta |
16815540 |
T |
 |
| Q |
120 |
gtacatgtttagacatgttgagtttgacgaaatcacagtagcactgtaattttgtagaagatctaaagtgtagttt |
195 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
16815539 |
gtacatgtttggacatgttgagtttgacgaaatcacagtagcaccgtaattttgtagaagatctaaagtggagttt |
16815464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 98 - 156
Target Start/End: Complemental strand, 16815900 - 16815842
Alignment:
| Q |
98 |
tttaaaactaaacatactactagtacatgtttagacatgttgagtttgacgaaatcaca |
156 |
Q |
| |
|
||||||||||||||||| ||||||| |||||| || | ||||||||| ||||||||||| |
|
|
| T |
16815900 |
tttaaaactaaacataccactagtatatgtttggatacgttgagtttaacgaaatcaca |
16815842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University