View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7836_low_13 (Length: 379)
Name: NF7836_low_13
Description: NF7836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7836_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 195 - 360
Target Start/End: Complemental strand, 4376155 - 4375993
Alignment:
| Q |
195 |
ttatgaacaaaggagtgtattatgatgctgctcctcctttcagagtatcagtattcatattttcttcctttttaccaagagtgcaaacaatctcaaaaga |
294 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4376155 |
ttatgaacaaaggagtgtattatg---ctgcgtctcctttcagagtatcagtattcatattttcttcctttttaccaagagtgcaaacaatctcaaaaga |
4376059 |
T |
 |
| Q |
295 |
tcaaacacgtattcatgttcttttcagtatgcttgtactccaccttgtttttccaaatatggctaa |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4376058 |
tcaaacacgtattcatgttcttttcagtatgcttgtactccaccttgtttttccaaatatggctaa |
4375993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 10 - 126
Target Start/End: Complemental strand, 4376308 - 4376193
Alignment:
| Q |
10 |
gtggtgtaggtcaactttgaaattagctacattatgcattttgttgatgttgattgatggcgggaaggtgcaaccttttattcttttggtgcaggtacct |
109 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4376308 |
gtggtgtaggtcaactt-gaaattagccacattatgcattttgttgatgttgattgatggcgggaaggtgctaccttttattcttttggtgcaggtacct |
4376210 |
T |
 |
| Q |
110 |
ttttgatgaagatacta |
126 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4376209 |
ttttgatgaagatacta |
4376193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University