View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7836_low_16 (Length: 354)
Name: NF7836_low_16
Description: NF7836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7836_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 16 - 333
Target Start/End: Complemental strand, 5788412 - 5788095
Alignment:
| Q |
16 |
ttggtgttactgcaggtgtagaagctgtcggtggtgaactcaccggcaccggtgttggtggagaactcactggaactggtgctggtggtgaactcactgg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5788412 |
ttggtgttactgcaggtgtagaagctgtcggtggtgaactcactggcaccggtgttggtggagaactcactggaactggtgctggtggtgaactcactgg |
5788313 |
T |
 |
| Q |
116 |
agctggttttggtggtgtgctcactggagcaacgactggtggtgatgcagctggagatttagcaaccggaactggagcagctggagaaacagccggagtt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5788312 |
agctggttttggtggtgtactcactggagcaacgactggtgatgatgcagctggagatttagcaaccggaactggagcagctggagaaacagccggagtt |
5788213 |
T |
 |
| Q |
216 |
acagttgcagcagtgggagatgaagctggtggtgatgattttggagaagcgactggagcgggtgattttggtttggtaggtgctgcgacgggagcagcag |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5788212 |
acagttgcagcagtgggagatgaagctggtggtgatgattttggagaagcgactggagcgggtgattttggtttggtaggtgctgcgacgggagcagcag |
5788113 |
T |
 |
| Q |
316 |
aaggagtggtgacggtag |
333 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5788112 |
aaggagtggtgacggtag |
5788095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University