View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7836_low_25 (Length: 220)
Name: NF7836_low_25
Description: NF7836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7836_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 6714376 - 6714192
Alignment:
| Q |
17 |
tggtggtcttgggttgaaagatgtaaggttttttaacatagttttgttggcaaagtggatgtggaatttactatcaaaaggtgaatcgttgctgaagaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||| |
|
|
| T |
6714376 |
tggtggtcttgggttgaaagatgtaaggctttttaacatagttttgttggcaaagtggatgtggaatttattatcaaaaggtgaatcgttacggaagaag |
6714277 |
T |
|
| Q |
117 |
gtgttgatagtaaagtatatgaatctattttggtcaatcctgatgtgtctagttacaatgtattgtatcttgcttccttgtggtc |
201 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6714276 |
gtgttgatagcaaagtatatgaatctattttggtcaatcctgatgtgcctagttacaatgtattgtatcttgcttccttgtggtc |
6714192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University