View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7837_high_8 (Length: 262)
Name: NF7837_high_8
Description: NF7837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7837_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 41084699 - 41084456
Alignment:
| Q |
1 |
gcgtcacatctctatagacgatgacgacatgatgtcgtcggcgtgacaaatgagtttgtcggcgtgagagtggaggttgtgttgcagacgaggtaaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41084699 |
gcgtcacatctctatagacgatgacgacatgatgtcgtcggcgtgacaaatgagtttgtcggcttgagagtggaggttgtgttgcagatgaggtaaaatt |
41084600 |
T |
 |
| Q |
101 |
caggttgattcaatacatatcgagctaagtcaaattaaataaaattcaactaagcttgattcatatttacatcttcacataaaaactttaaggcattata |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41084599 |
caggttgatccaatacatatcgagctaagtcaaattaaataaaattcaactaagcttgattcatatttacatcttcacataaaaactttaaggcattata |
41084500 |
T |
 |
| Q |
201 |
tacgagttttctcatttatatgatgcttacatccacatttttag |
244 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41084499 |
tacgagttttctcatttatacgatgcttacatccacatttttag |
41084456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University