View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7837_high_9 (Length: 259)
Name: NF7837_high_9
Description: NF7837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7837_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 241
Target Start/End: Complemental strand, 38696245 - 38696015
Alignment:
| Q |
11 |
gagatgaatttgtggcaaggtttcaacgtccgtcctacttcagtttgatcgcctctctcctcctctatttccattatttttatttcactacaattatcac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38696245 |
gagatgaatttgtggcaaggtttcaacgtccgtcctacttcagtttgatcgcctctctcctcctctatttccattatttttatttcactacaattatcac |
38696146 |
T |
|
| Q |
111 |
tatgaagaattatttttggttatatgcagacatcaattgaaatttagatttaggcatagagttgtgtgtgtcaggaagatgaacaggggaatgaggaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38696145 |
tatgaagaattatttttggttatatgcagacatcaattgaaatttagatttaggcatagagttgtgtgtgtcaggaagatgaacaggggaatgaggaaaa |
38696046 |
T |
|
| Q |
211 |
agatggagnnnnnnnccagtgtgctgggttt |
241 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
38696045 |
agatggagaaaaaaaccagtgtgctgggttt |
38696015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University