View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7837_low_11 (Length: 254)
Name: NF7837_low_11
Description: NF7837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7837_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 2521693 - 2521521
Alignment:
| Q |
1 |
aaccatacttgtgtgcccaaatgagggaatacagatgagattgcctgtccagctttcctatcagcggtcatcaatgcaaccccaaattgtggatgatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2521693 |
aaccatacttgtgtgcccaaatgagggaatacagatgagattgcctgtccagctttcctatcagcggtcatcaatgcaaccccaaattgtggatgatttg |
2521594 |
T |
|
| Q |
101 |
ccaagagccgaagaatctaataaaaatgaataaaaatctcttaacaaagttacaccagatttaaacagatatt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2521593 |
ccaagagccgaagaatctaataaaaatgaataaaaatctcttaacaaagttacaccagatttaaacagatatt |
2521521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 170 - 236
Target Start/End: Complemental strand, 2521423 - 2521357
Alignment:
| Q |
170 |
tattaattagttatgttagttttttgcctccttcatcctccgggttcgaacctaggagctccaacat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2521423 |
tattaattagttatgttagttttttgcctccttgatcctccgggttcgaacctaggagctccaacat |
2521357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University