View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7838_high_2 (Length: 291)
Name: NF7838_high_2
Description: NF7838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7838_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 23 - 257
Target Start/End: Complemental strand, 31465206 - 31464972
Alignment:
| Q |
23 |
cgaaaaaatgttgttttgcttagaaatgaggacagcgacacatcctcatcagtgatcaccgatgagaataattatggtaacaacgttggtgaaaatcaag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
31465206 |
cgaaaaaatgttgttttgcttagaaatgaggacaatgacacatcctcatcggtgatcaccgatgagaataattatggtaacaacgtcggtgaaaatcagg |
31465107 |
T |
 |
| Q |
123 |
ttaactcgtgtttcattccatcagatacattgatgttggagcctccgttgaacccttacatgacaaacttcttggcgtcgagctcagccgagttcatgtg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465106 |
ttaactcgtgtttcattccatcagatacattgatgttggagcctccgttgaacccttacatgacaaacttcttggcgtcgagctcagccgagttcatgtg |
31465007 |
T |
 |
| Q |
223 |
ctcaagtcagcccttattgaactactcagattcat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465006 |
ctcaagtcagcccttattgaactactcagattcat |
31464972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University