View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7839_high_25 (Length: 299)
Name: NF7839_high_25
Description: NF7839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7839_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 33 - 277
Target Start/End: Original strand, 46740744 - 46740988
Alignment:
| Q |
33 |
tcctacccattgcatacctatagtttagtaactctatttggttacattctagtctagtctagtagcatgcactagtaaacaaaaccgtcattctccattc |
132 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46740744 |
tcctacccattgcataactatagtttagtaactctatttggttacattctagtctagtctagtagcatgcactagtaaacaaaactgtcattctccattc |
46740843 |
T |
 |
| Q |
133 |
atttcatggtatacatttataatatccccgacaaatcatcatcctttagctttagtagcataatggaaatgatgtggactcttttagtggagaggttcat |
232 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46740844 |
atttcatgatatacatttataatatccccgacaaatcatcatcctttagctttagcagcataatggaaatgatgtggactcttttagtggagaggttcat |
46740943 |
T |
 |
| Q |
233 |
tcactttgatggagaaaattttgaaaagcaatacaatcgtggctg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46740944 |
tcactttgatggagaaaattttgaaaagcaatatcatcgtggctg |
46740988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 46740631 - 46740664
Alignment:
| Q |
1 |
atatgtcggagatgtgaatgaaattcaatttctc |
34 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
46740631 |
atatgttggagatgtgaatgaaattcaatttctc |
46740664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University