View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7839_high_36 (Length: 211)
Name: NF7839_high_36
Description: NF7839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7839_high_36 |
 |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0148 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 106
Target Start/End: Complemental strand, 28201 - 28145
Alignment:
| Q |
50 |
tgatgaattggaagatatcagctttgaggtttataatttgttgaccaatttcagttt |
106 |
Q |
| |
|
|||| ||||||| || |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28201 |
tgatcaattggacgacatcagctttgaggtttataatttgttgaccaacttcagttt |
28145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University