View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7839_low_28 (Length: 323)
Name: NF7839_low_28
Description: NF7839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7839_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 34569030 - 34569333
Alignment:
| Q |
1 |
tatggtgcaatagtatacttcttttaaaatattaaaaatatatgccttcagatttcacatggtatttgatcggtgcatgataatacgagccaaatggagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34569030 |
tatggtgcaatagtatacttcttttaaaatattaaaaatatatgccttcaaatttcacatggtatttgatctgtgcatgataatacgagccaaatggagt |
34569129 |
T |
 |
| Q |
101 |
gggttctaagattttgtgttgttgttgacgatggttgttctttacctgcacatggtggtctacctgcaaagacactttgacgtttaagttagcaaggtct |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34569130 |
ggattctaagattttgtgttgttgttgacgatggttgttctttacctgcacatggtggtctacctgcaaagacactttgacgtttaagttagcaaggtct |
34569229 |
T |
 |
| Q |
201 |
ctagatgttttgaggtttatctcgaaatgagaatgtgtatcttattttgcatttggttgctctatttatctattcctacgtgttacacaagtgtaagtta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34569230 |
ctagatgttttgaggtttatctcgaaatgaaaatgtgtatcttattttgcatttggttgctctatttatctattcctacgtgttacacaagtgtgagtta |
34569329 |
T |
 |
| Q |
301 |
tgtt |
304 |
Q |
| |
|
|||| |
|
|
| T |
34569330 |
tgtt |
34569333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University