View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7839_low_36 (Length: 265)
Name: NF7839_low_36
Description: NF7839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7839_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 41025597 - 41025343
Alignment:
| Q |
1 |
accctaaccccttcatcttcttcctcacttcaccatttcacacactccaaacgtttcgctctcaatcacccatttcctgcttctcttcctcaatggcgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41025597 |
accctaaccccttcatcttcttcctcacttcaccatttcacacactccaaacgtttcgctctcaatcacccatttcctgcttctcttcctcaatggcgtt |
41025498 |
T |
|
| Q |
101 |
ctcttcagctcctgatccttctctcgagaagcaattcggcgaattcagaactcacctcgaacaatctggaaccttacgcgaccgaattcgaaccgttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41025497 |
ctcttcagctcctgatccttctctcgagaagcaattcggcgaattcagaactcacctcgaacaatctggaaccttacgcgaccgaattcgaaccgttgtt |
41025398 |
T |
|
| Q |
201 |
tccgaaattgaatccaccactaggcttatgtatgctagcattcttcttgttcatc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41025397 |
tccgaaattgaatccaccactaggcttatgtatgctagcattcttcttgttcatc |
41025343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University