View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7839_low_46 (Length: 210)
Name: NF7839_low_46
Description: NF7839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7839_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 51 - 194
Target Start/End: Complemental strand, 45868305 - 45868161
Alignment:
| Q |
51 |
aaggatattagtataacttactccacatcaataataaaataaa-ttttcataacataaattcttagaaggaaattgctaaatgctgggagagaaattctc |
149 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
45868305 |
aaggatactagtataacttactccacatcaataataaaataaaattttcataacataaattcttagaaggaaattgctaaatgccgagagagaaattctc |
45868206 |
T |
|
| Q |
150 |
gcaaaagtttacgaattggtttttgaacaatatctcacataaaac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45868205 |
gcaaaagtttacgaattggtttttgaacaatatctcacataaaac |
45868161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University