View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7839_low_49 (Length: 201)
Name: NF7839_low_49
Description: NF7839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7839_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 14 - 183
Target Start/End: Original strand, 37420960 - 37421127
Alignment:
| Q |
14 |
atgaattcaatcgaaaaggaaaacaaacccatagatgaacgaacacctttggttgaaacaacattttacactgtaccttgttcgttcctttatggcgatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
37420960 |
atgaattcaatcgaaaaggaaaacaaacccatagatgaacgaacacctttggttgaaacaacatttttcact--accttgttcgttcctttatggcgatg |
37421057 |
T |
 |
| Q |
114 |
ggagatggatagagcttcgtgatgggtttagtgtgaacgacgctttacgacggaagttctacgccggtgg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37421058 |
ggagatggatagagcttcgtgatgggtttagtgtgaacgacgctttacgacgtaagttctacgccggtgg |
37421127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University