View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7840_high_7 (Length: 382)
Name: NF7840_high_7
Description: NF7840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7840_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 22 - 296
Target Start/End: Original strand, 45702665 - 45702939
Alignment:
| Q |
22 |
tctgccacacttttatgcctttggattttgataacataagtccgctactaaccctttgggggcaatattacataaattataccttgaggtgtaactagga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45702665 |
tctgccacacttttatgcctttggattttgataacataagtccgctactaaccctttgggggcaatattacataaattataccttgaggtgtaactagga |
45702764 |
T |
|
| Q |
122 |
ttggtctactttgttatgcgttatgaccataaatctcaaaccgtagcagttgaattaggaacttgatttacccaacgaggagataggggatcagaggaat |
221 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45702765 |
ttgctctactttgttatgcgttatgaccataaacctcaaaccgtagcagttgaattaggaacttgatttacccaacgaggagataggggatcagaggaat |
45702864 |
T |
|
| Q |
222 |
ccttattgtttcaccattctggttcattctcttttatttattctcgttattttgcaagcaacaaaacttatgcgg |
296 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45702865 |
ccttattgtttcaccattttcgttcattctcttttatttattctcgttattttgcaagcaacaaatcttatgcgg |
45702939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 315 - 367
Target Start/End: Original strand, 45702963 - 45703015
Alignment:
| Q |
315 |
cattaccgagtaggaaactcacaatctctatggagactatatctacttactat |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45702963 |
cattaccgagtaggaaactcacaatctctatggagactatatctacttactat |
45703015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University