View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7840_low_12 (Length: 266)
Name: NF7840_low_12
Description: NF7840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7840_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 30084320 - 30084579
Alignment:
| Q |
1 |
gacattgcggcatcatcctcaaaatctccgactccttataatccgaaatacatatcgaacaaatggtgtcataatcatgattaatcgtggcaatgttgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30084320 |
gacattgcggcatcatcctcaaaatctccgattccttataatccgaaatacatatcgaacaaacggtgtcataatcatgattaatcgtggcaatgttgtt |
30084419 |
T |
|
| Q |
101 |
tttgttgaaggtgaatgtgtggtaagagttgatgatgctacgagggagcccttccacggcgtttttattatcgaccacatgttgtatagatactgggttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
30084420 |
tttgttgaaggtgaatgtgtggtaagagttgatgatgctacgagggagcccttccacggtgtttttatcatcgaccacatgttgtatagatgctgggttc |
30084519 |
T |
|
| Q |
201 |
aaattaggattttgaacgcgatgatcaccatgtgtggaaaaataaacgtaacaaactcga |
260 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
30084520 |
aaattaggattttgaatgcgatgatcaccatgtgagaaaaaataaacgtaacaaactcga |
30084579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University