View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7840_low_15 (Length: 230)
Name: NF7840_low_15
Description: NF7840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7840_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 11 - 214
Target Start/End: Original strand, 30084641 - 30084846
Alignment:
| Q |
11 |
tggtgttcatgcttggcgaagatgtatcggaggtggtttgagaggacatgagcggcagaaggtggaggacaaaattccttnnnnnnnnnn--gggtggag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
30084641 |
tggtgttcatgcttggcgaagatgtatcggaggcggtttgagaggacatgagtggtagaaggtggaggacaaaattccttcaaaaaaaaaaagggtggag |
30084740 |
T |
|
| Q |
109 |
gacacaatttgtgatatgatgtatagagctagccaaattggctggaatattaatttggagttttannnnnnngggtttagctagggtggagaaatgagga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30084741 |
gacacaatttgtgatatgatgtatagagctagccaacttggctggaatattaatttggagttttatttttttgggtttagctagggtggagaaatgagga |
30084840 |
T |
|
| Q |
209 |
aggttt |
214 |
Q |
| |
|
|||||| |
|
|
| T |
30084841 |
aggttt |
30084846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University